How Do Cells Make Proteins -- Copyright © 2017 The Concord Consortium. All rights reserved. The software is licensed under the MIT license. Please provide attribution to the Concord Consortium and the URL http://concord.org.
Proteins in the cell
Each cell in your body contains all of the instructions for building a human body—specifically, your human body–in its DNA. Amazing!
The cell is the smallest living unit. The photo shows stomach cells. The dark spots indicate the cell nuclei, where the DNA is contained. (There are also lots of other structures in the cell, such as ribosomes and endoplasmic reticulum, which cannot be seen in this picture, but they're there.)
Proteins carry out the work of the cell. Your body contains tens of thousands of different types of proteins, each with their own specific job to do. Each protein is coded for in the DNA. But you don't have enough different strands of DNA for each DNA strand to code for a single protein. You have 23 pairs of chromosomes, each one a single strand of DNA.
How does the cell make proteins from the information in the DNA?
The cell is the smallest living unit. The photo shows stomach cells. The dark spots indicate the cell nuclei, where the DNA is contained. (There are also lots of other structures in the cell, such as ribosomes and endoplasmic reticulum, which cannot be seen in this picture, but they're there.)
Proteins carry out the work of the cell. Your body contains tens of thousands of different types of proteins, each with their own specific job to do. Each protein is coded for in the DNA. But you don't have enough different strands of DNA for each DNA strand to code for a single protein. You have 23 pairs of chromosomes, each one a single strand of DNA.
How does the cell make proteins from the information in the DNA?
Transcription
In human cells (and in all eukaryotic cells), the DNA is confined to the nucleus (the dark spot in the cells you saw on page 1). The 23 pairs of chromosomes in the nucleus of each of your cells contain all of the information to make every part of your body.
The information in the DNA is encoded by just four types of nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). It takes three nucleotides (called a triplet -- Codon) to code for each amino acid of a protein. There are 20 different amino acids that make up the proteins in your body.
Proteins are made in the cytoplasm, outside of the nucleus, on structures called ribosomes. But the information for making the proteins is stuck inside the nucleus.
On the simulation below, explore how an mRNA copy is made of the DNA. The nucleotide binding is very specific; only complementary nucleotides will bind to each other, ensuring a correct copy.
Use the A, U, G and C buttons to place the correct RNA nucleotide with each DNA nucleotide.
Start with the first non-green pair of nucleotides. You'll be done when you reach the red nucleotides.
After exploring and completing the model, answer the questions below.
Translation
After transcription, there is an mRNA copy of the DNA. The mRNA leaves the nucleus and goes out to the cytoplasm, where it joins up with a ribosome.
The ribosome has two subunits—one large and one small. (The ribosome is made up of proteins and a type of RNA called ribosomal RNA (rRNA).)
The process of making a protein from an mRNA is called translation—translating the information in the nucleotides into a string of amino acids.
The ribosome has two subunits—one large and one small. (The ribosome is made up of proteins and a type of RNA called ribosomal RNA (rRNA).)
The process of making a protein from an mRNA is called translation—translating the information in the nucleotides into a string of amino acids.
On the simulation below, click the Translate or Translate step by step button to start translation. After you are completed with the simulation, answer the questions below.
Protein folding
What happens to the protein after translation?Proteins can't do their jobs in the cell until they fold into the correct shapes. Different proteins have different shapes, depending on their function in the cell. Remember shape impacts function!
For instance, fibroin, a protein in silk, folds into a series of flat sheets. But aquaporin, a protein that allows water to flow across the cell membrane, folds into a cylindrical shape. The shape of the protein tells you a little bit about what it does in the cell. Remember shape impacts function -- this is meant to be redundant!
But how do proteins "know how to" fold into the correct shape?
Remember those 20 different amino acids that make up your proteins? Each of those amino acids have different properties that determine their interactions with the other amino acids and the proteins environment. Because of those properties and the interaction with the proteins environment, the order amino acids has a major impact on how it folds.
Take a look at the simulation below. You will see two new vocab words that we haven't talked about yet but we will later. Hydrophillic is a property that interacts well with water and hydrophobic is a property that doesn't interact well with water. Play around with the simulation and see if you can change the way the protein folds. How do you think that will impact its function?
When mistakes happen
DNA has the information for building a protein, but it can't leave the nucleus. The information can be copied into mRNA, which can leave the nucleus. The information in the mRNA is translated into an amino acid sequence at the ribosome. And the amino acids fold into a specific shape that allows the protein to do its job in the cell.
But what if something goes wrong?
One way that something can go wrong is if the DNA is changed or mutated.
But what if something goes wrong?
One way that something can go wrong is if the DNA is changed or mutated.
Read the following directions, complete the simulation below, and answer the question following it.
Mutations are mistakes in the DNA sequence.
Click on a DNA nucleotide to mutate it. You can substitute a different nucleotide, insert a new nucleotide or delete a nucleotide.
What effect does the change have on the protein? You can switch quickly between the DNA sequence view and the protein view by using the Show DNA and Show protein buttons.
You can also go step by step through transcription and translation to remind yourself of the process by which information in the DNA yields a protein.
Click on a DNA nucleotide to mutate it. You can substitute a different nucleotide, insert a new nucleotide or delete a nucleotide.
What effect does the change have on the protein? You can switch quickly between the DNA sequence view and the protein view by using the Show DNA and Show protein buttons.
You can also go step by step through transcription and translation to remind yourself of the process by which information in the DNA yields a protein.
On the same simulation below click the button that says edit the DNA. Type in the following DNA sequence:
ATGCTGACTCCTGAGGAGAAGTCTTAG
Click Apply and then look at the protein it created. On a separate sheet of paper write down observations that you see in regards to its shape. Be specific.
Click on the button edit DNA. Type in the following DNA sequence:
ATGCTGACTCCTGTGGAGAAGTCTTAG
Click Apply and then look at the protein it created. On a separate sheet of paper write down observations that you see in regards to its shape. Be specific.
After you are done running the simulation and making your observations, answer the questions below.